View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9566_low_10 (Length: 275)
Name: NF9566_low_10
Description: NF9566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9566_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 267
Target Start/End: Complemental strand, 13713150 - 13712906
Alignment:
| Q |
19 |
ctaaccctaaaatcttttcatctcagttgtatgtctgaactcactctgggagaatgagagtgactgtttctacagatgggttgaagctgcaaaacaccgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||| |||||||||||||||| |||||||||||| |
|
|
| T |
13713150 |
ctaaccctaaaatcttttcatctcagttgtatgtttgaactc----tgggagaatgagagtgactatttcaacagatgggttgaagcggcaaaacaccgc |
13713055 |
T |
 |
| Q |
119 |
cacattgaggttctccgtctacactttccatattttttacacgtccctttggcacctaccatcttctgctgcaaaacccttgtgaatctgacattgtcgc |
218 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
13713054 |
cacattgaggttctccgtctgcacttttcatattttttatacgtccctttggcgcctacaatcttctgctgcaaaacccttgtgaacctgacattgacgc |
13712955 |
T |
 |
| Q |
219 |
atattcgtgttgccactatgtttcattgttctattaatcttcctttgct |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13712954 |
ttattcgtgttgccactatgtttcattgttctattaatcttcctttgct |
13712906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 202
Target Start/End: Original strand, 19805621 - 19805667
Alignment:
| Q |
156 |
tacacgtccctttggcacctaccatcttctgctgcaaaacccttgtg |
202 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
19805621 |
tacacgtccctttagcacctactgtcttctgctgcaaaacacttgtg |
19805667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University