View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9567_high_12 (Length: 243)
Name: NF9567_high_12
Description: NF9567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9567_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 58 - 235
Target Start/End: Complemental strand, 50676406 - 50676230
Alignment:
| Q |
58 |
aagattggctgtaacctgaaactgcatgtcgtttttagagctgcgagttccggtccggtccg-gtccttgtgaaaactatgaagcatatgaaattatgat |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||| |
|
|
| T |
50676406 |
aagattggctgtaacctgaaactgcatgtcgtttttagagctgcgagttccggtccggtccttgtgc--gtgaaaactatgaagcatatgaaattatgat |
50676309 |
T |
 |
| Q |
157 |
tagccaaccctttttgtatagagtgggtcatgcagatcatgatatcacaaagttgtcatactaaaattggagtataatc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50676308 |
tagccaaccctttttgtatagagtgggtcatgcagatcatgatatcacaaagttgtcatactaaaattggagtaaaatc |
50676230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 20 - 67
Target Start/End: Complemental strand, 50676478 - 50676429
Alignment:
| Q |
20 |
agtaccatttatatatttttt--agtgaattaccatttataagattggct |
67 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
50676478 |
agtaccatttatattttttttttagtgaattaccatttataagattggct |
50676429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University