View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9567_low_31 (Length: 225)
Name: NF9567_low_31
Description: NF9567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9567_low_31 |
 |  |
|
| [»] scaffold0536 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0536 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: scaffold0536
Description:
Target: scaffold0536; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 9948 - 9742
Alignment:
| Q |
1 |
ttgaaagagagtcttggaatttgaagcttgtttgcaagttcatcaacccaaggaaacaagaaatccgtcacgatgcaatccggtgggtgctgctccacga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9948 |
ttgaaagagagtcttggaatttgaagcttgtttgcaagttcatcaacccaaggaaacaaaaaatctgtcacgatgcaatccggtgggtgctgctccacga |
9849 |
T |
 |
| Q |
101 |
agtgttggatgggtggtcgaaggagagtggtagcttgaaagattttgaccatgttattgaagtcagtggcggcagatagactttctacaccgtcggggag |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9848 |
agtgttggatgggtggtcggaggagagtggtagcttgaaagattttgaccatgttattgaagtcagtggcggcagagagactttctacaccgtcggggag |
9749 |
T |
 |
| Q |
201 |
gcctact |
207 |
Q |
| |
|
||||||| |
|
|
| T |
9748 |
gcctact |
9742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0536; HSP #2
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 9 - 143
Target Start/End: Complemental strand, 5956 - 5822
Alignment:
| Q |
9 |
gagtcttggaatttgaagcttgtttgcaagttcatcaacccaaggaaacaagaaatccgtcacgatgcaatccggtgggtgctgctccacgaagtgttgg |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5956 |
gagtctaggaatttgaagcttgtttgcaagttcatcaacccaaggaaacaagaaatccgccacaatgcaatccggtgggtgctgctccacgaagtgttgg |
5857 |
T |
 |
| Q |
109 |
atgggtggtcgaaggagagtggtagcttgaaagat |
143 |
Q |
| |
|
||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
5856 |
atgggtggttggaggagagtggtggcttgaaagat |
5822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0536; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 101
Target Start/End: Complemental strand, 897 - 812
Alignment:
| Q |
16 |
ggaatttgaagcttgtttgcaagttcatcaacccaaggaaacaagaaatccgtcacgatgcaatccggtgggtgctgctccacgaa |
101 |
Q |
| |
|
||||| |||||||||||||| || ||||| |||||||| || || ||||||| ||||||||||| ||||| | ||| |||||||| |
|
|
| T |
897 |
ggaatgtgaagcttgtttgccagctcatccacccaagggaataaaaaatccgctacgatgcaatcaggtggttcctgttccacgaa |
812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 48911798 - 48911652
Alignment:
| Q |
1 |
ttgaaagagagtcttggaatttgaagcttgtttgcaagttcatcaacccaaggaaacaagaaatccgtcacgatgcaatccggtgggtgctgctccacga |
100 |
Q |
| |
|
||||||| ||||| |||||||| ||||||||||||||||||| |||||||||| ||| |||||| | |||||||||||| ||||||||||||||||||| |
|
|
| T |
48911798 |
ttgaaagcaagtctaggaatttgtagcttgtttgcaagttcatgaacccaaggatacatgaaatcagccacgatgcaatctggtgggtgctgctccacga |
48911699 |
T |
 |
| Q |
101 |
agtgttggatgggtggtcgaaggagagtggtagcttgaaagattttg |
147 |
Q |
| |
|
|||||||||||| |||||| || ||||||| ||| || |||||||| |
|
|
| T |
48911698 |
agtgttggatggttggtcggagtagagtggctgctcgatagattttg |
48911652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 101
Target Start/End: Original strand, 48951978 - 48952063
Alignment:
| Q |
16 |
ggaatttgaagcttgtttgcaagttcatcaacccaaggaaacaagaaatccgtcacgatgcaatccggtgggtgctgctccacgaa |
101 |
Q |
| |
|
||||| || ||||| ||||| || |||||| |||| || || || ||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
48951978 |
ggaatgtgcagcttctttgctagctcatcagcccacgggaataaaaaatccgccacgatgcaatcaggtgggtgctgctccacgaa |
48952063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University