View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9568_high_2 (Length: 375)
Name: NF9568_high_2
Description: NF9568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9568_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 18 - 360
Target Start/End: Complemental strand, 25346869 - 25346527
Alignment:
| Q |
18 |
gtgggccatcatatatctacaaaagacaatgaagacatagaaagtagaactctgtcgttgtctatgttgactnnnnnnnnnnnnnnnnnnnnngagaata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25346869 |
gtgggccatcatatatctacaaaagacaatgaagacatagaaagtagaactctgtcgttgtctatgttgactaaaacaaaaacaaaaacaaaagagaata |
25346770 |
T |
 |
| Q |
118 |
aagtctcatctgtgtctgtaatatcattttgattgcttgtttgttgtattgcatttatctccgtatatgggtttagatcaatatttcatattctcatatc |
217 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25346769 |
aagtctcatctatgtctgtaatatcattttgagtgcttgtttgttgtattgcatttatctccgtatatgggtttagatcaatatttcatattctcatatc |
25346670 |
T |
 |
| Q |
218 |
ctaatctgtttttaaaaggtatgatgcttttccactctaaatttacattactttttaatttgttgcagtccacattaatgcaaagttggtttggctgcaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25346669 |
ctaatctgtttttaaaaggtatgatgcttttccactctaaatttacattactttttaatttgttgcagtccacattaatgcaaagttggtttggctgcaa |
25346570 |
T |
 |
| Q |
318 |
tttttgaaaatcagtatgtcacttagtgcatggggaagttttt |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25346569 |
tttttgaaaatcagtatgtcacttagtgcatggggaagttttt |
25346527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University