View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9568_high_9 (Length: 240)
Name: NF9568_high_9
Description: NF9568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9568_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 7821903 - 7822001
Alignment:
| Q |
1 |
tgagctactttatgcattgtttctcaaatatgaaacttcttatta-------atgcatggtgctgctgatggaaacccaaagcttttcccgctgtgaat |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7821903 |
tgagctactttatgcattgtttctcaaatatgaaacttcttattataatataatgcatggtgctgctgatggaaacccaaagcttttcccgctgtgaat |
7822001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 7812372 - 7812411
Alignment:
| Q |
1 |
tgagctactttatgcattgtttctcaaatatgaaacttct |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7812372 |
tgagctactttatgcattgtttctcaaatatgaaacttct |
7812411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University