View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9568_low_12 (Length: 335)
Name: NF9568_low_12
Description: NF9568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9568_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 19 - 325
Target Start/End: Complemental strand, 38466406 - 38466100
Alignment:
| Q |
19 |
cttctgagtcaggcttagcccatgaagggattttttcatcggatttacttgactctgctgagcctttggtcactgccactgttaaaaacttgtgtggtga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466406 |
cttctgagtcaggcttagcccatgaagggattttttcatcggatttacttgactctgctgagcctttggtcactgccactgttaaaaacttgtgtggtga |
38466307 |
T |
 |
| Q |
119 |
ttttttgttactgaggaacgttttctgacataggggaatgcctaaaaaggttgtgggttgtgatgcatggcggttttgtaaggtacataccgttgatagt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466306 |
ttttttgttactgaggaacgttttctgacataggggaatgcctaaaaaggttgtgggttgtgatgcatggcggttttgtaaggtacataccgttgatagt |
38466207 |
T |
 |
| Q |
219 |
gaggatgagaaggtagaacttgctgctactgccatggtgtttgtaaattgtaacgcaagtttagccagtgaaatcttatcctacgttagttagggtatgg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466206 |
gaggatgagaaggtagaacttgctgctactgccatggtgtttgtaaattgtaacgcaagtttagccagtgaaatcttatcctacgttagttagggtatgg |
38466107 |
T |
 |
| Q |
319 |
gcctatg |
325 |
Q |
| |
|
||||||| |
|
|
| T |
38466106 |
gcctatg |
38466100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University