View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9568_low_14 (Length: 334)
Name: NF9568_low_14
Description: NF9568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9568_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 108 - 330
Target Start/End: Complemental strand, 7613483 - 7613261
Alignment:
| Q |
108 |
ttaagtagtaagttcaactttcaacactagacgctctttaaaattgtctagaaatccacaactgagaaatagagtatctaattcaacgtaatcacctgat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7613483 |
ttaagtagtaagttcaactttcaacactagacgctctttaaagttgtctagaaatccacaactgagaaatagagtatctaattcaacgtaatcacctcat |
7613384 |
T |
 |
| Q |
208 |
nnnnnnnntcattattccatatgcaagttaacctacatatcaccttatcaactgagcaaaccacaaatcaaacaagcaaacaactaaccatctgatcacg |
307 |
Q |
| |
|
||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7613383 |
aaaaaaaatcattattcaacgtgcaaattaacctacatatcaccttatcaactgagcaaaccacaaattaaacaagcaaacaactaaccatctgatcacg |
7613284 |
T |
 |
| Q |
308 |
attagttggctaaacaccaaact |
330 |
Q |
| |
|
||||||||||||| ||| ||||| |
|
|
| T |
7613283 |
attagttggctaagcactaaact |
7613261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 7613591 - 7613526
Alignment:
| Q |
1 |
ctataaatgtttatttgaaggctatattcaacacataataaatcaaac-aagtctttacatatctc |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7613591 |
ctataaatgtttatttgaaggctatattcaacacataataaatcaaactaagtctttacatatctc |
7613526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University