View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9568_low_22 (Length: 278)
Name: NF9568_low_22
Description: NF9568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9568_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 152 - 213
Target Start/End: Original strand, 2860743 - 2860804
Alignment:
| Q |
152 |
gggttgaagatgaagcgcagaaacggtagaagaaaacgtcgtcgtcttcatcgtcgctattg |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2860743 |
gggttgaggatgaagcgcagaaacggtagaagaaaacgtcgtcgtcttcatcgtcgctattg |
2860804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 2860610 - 2860662
Alignment:
| Q |
19 |
taatctagatttgaaacgtatatggttgattttgatggtgctaaggtttctcc |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2860610 |
taatctagatttgaaacgtatatggttgattttgatggtgctaaggtttctcc |
2860662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University