View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9568_low_29 (Length: 247)
Name: NF9568_low_29
Description: NF9568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9568_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 41300276 - 41300493
Alignment:
| Q |
19 |
aagttacacttagataatatattgcttcaatatgttttttatcatgcctctatttctcactttgaaattaaattaaatataatatcttcatgtaagacga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41300276 |
aagttacacttagataatatattgcttcaatatgttttttatcatgcctctatttctcactttgaaattaaattaaatataatatcttcatgtaagacga |
41300375 |
T |
|
| Q |
119 |
gccttnnnnnnnnnntctctttgtaagatgaagggtgcaatttttaaatttataataccgccctcatctttaacattattgagtttggtgtataagtatg |
218 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41300376 |
gcctt-aaaaaaaaatctctttgtaagatgaagggtgcaatttttaaatttataataccgccctcatctttaacattattgagtttggtgtataagtatg |
41300474 |
T |
|
| Q |
219 |
aataatgagtgtccctttg |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41300475 |
aataatgagtgtccctttg |
41300493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University