View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9568_low_31 (Length: 240)

Name: NF9568_low_31
Description: NF9568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9568_low_31
NF9568_low_31
[»] chr8 (1 HSPs)
chr8 (33-225)||(7613634-7613832)


Alignment Details
Target: chr8 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 33 - 225
Target Start/End: Original strand, 7613634 - 7613832
Alignment:
33 ctactatattacatcacggctaaaactactaatgtagataatgaa------agcttagttacatcccaaaaaagtcttgtcggctagtaatttacttcca 126  Q
    ||||||||||||||||||||||||||||||||||||||||| |||      |||||||||||||||||||||||||||||||||||||||||||||||||    
7613634 ctactatattacatcacggctaaaactactaatgtagataacgaacatgtaagcttagttacatcccaaaaaagtcttgtcggctagtaatttacttcca 7613733  T
127 tattgccaaccatgtcatccataactcatttatcaagggaatgtcttcatgcacgtcttagctaatatattgctcatacggctgagttgaggtaaaaat 225  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7613734 tattgccaaccatgtcatccataactcatttatcaagggaatgccttcatgcacgtcttagctaatatattgctcatacggctgagttgaggtaaaaat 7613832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University