View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9568_low_31 (Length: 240)
Name: NF9568_low_31
Description: NF9568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9568_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 33 - 225
Target Start/End: Original strand, 7613634 - 7613832
Alignment:
| Q |
33 |
ctactatattacatcacggctaaaactactaatgtagataatgaa------agcttagttacatcccaaaaaagtcttgtcggctagtaatttacttcca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7613634 |
ctactatattacatcacggctaaaactactaatgtagataacgaacatgtaagcttagttacatcccaaaaaagtcttgtcggctagtaatttacttcca |
7613733 |
T |
 |
| Q |
127 |
tattgccaaccatgtcatccataactcatttatcaagggaatgtcttcatgcacgtcttagctaatatattgctcatacggctgagttgaggtaaaaat |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7613734 |
tattgccaaccatgtcatccataactcatttatcaagggaatgccttcatgcacgtcttagctaatatattgctcatacggctgagttgaggtaaaaat |
7613832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University