View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9568_low_32 (Length: 240)

Name: NF9568_low_32
Description: NF9568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9568_low_32
NF9568_low_32
[»] chr2 (2 HSPs)
chr2 (1-92)||(7821903-7822001)
chr2 (1-40)||(7812372-7812411)


Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 7821903 - 7822001
Alignment:
1 tgagctactttatgcattgtttctcaaatatgaaacttcttatta-------atgcatggtgctgctgatggaaacccaaagcttttcccgctgtgaat 92  Q
    |||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||    
7821903 tgagctactttatgcattgtttctcaaatatgaaacttcttattataatataatgcatggtgctgctgatggaaacccaaagcttttcccgctgtgaat 7822001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 7812372 - 7812411
Alignment:
1 tgagctactttatgcattgtttctcaaatatgaaacttct 40  Q
    ||||||||||||||||||||||||||||||||||||||||    
7812372 tgagctactttatgcattgtttctcaaatatgaaacttct 7812411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University