View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9568_low_40 (Length: 227)
Name: NF9568_low_40
Description: NF9568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9568_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 20050748 - 20050882
Alignment:
| Q |
1 |
atggtaaacgatgtcaggttcgaaattggtgaattatattatcttgtgttcatttctggctttgaatttctttcttcaagagtttggatccaaagctcaa |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20050748 |
atggtatacgatgtcaggttcgaaattggtgaattatattatcttgtgttcatttctggctttgaatttctttcttcaagagtttggatccaaagctcaa |
20050847 |
T |
 |
| Q |
101 |
ctcataccacaagatgaaggtacacttaatttcac |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
20050848 |
ctcataccacaagatgaaggtacacttaatttcac |
20050882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 210
Target Start/End: Original strand, 20050922 - 20050953
Alignment:
| Q |
179 |
ttgttaacactttcaaaaggaaaccgcctttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20050922 |
ttgttaacactttcaaaaggaaaccgcctttg |
20050953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University