View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9568_low_41 (Length: 227)
Name: NF9568_low_41
Description: NF9568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9568_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 32203793 - 32204015
Alignment:
| Q |
1 |
ggaaatggatatgtctcgtttcttagaggcagctgagttagatgtaattgaaagctctttaatttaattagtccacaccatgaatttattgataatagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32203793 |
ggaaatggatatgtctcgtttcttagaggcagctgagttagatgtaattgaaagctctttaatttaattagtccacaccatgaatttattgataatagaa |
32203892 |
T |
 |
| Q |
101 |
tttgttgcgacc------attgtaacgttgtacacactattgatattcttaatttgagataaaactggaactgattgaatttgttggagatgtttctacc |
194 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
32203893 |
tttgttgcgaccattgtaattgtaacgttgtacacattattgatattcttaatttgagataaaactggaactgattgaattggttggagatgtttttacc |
32203992 |
T |
 |
| Q |
195 |
tttggcttagttaatagtctctg |
217 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32203993 |
tttggcttagttaatagtctctg |
32204015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University