View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9569_high_5 (Length: 213)
Name: NF9569_high_5
Description: NF9569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9569_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 15 - 194
Target Start/End: Complemental strand, 5012259 - 5012080
Alignment:
| Q |
15 |
aaggtgaagtttccttgaggtatttgaagtggtggaagctcatcaatttcatccttagctatatttagcaaccaatcaacaaccttgctaggttggttta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012259 |
aaggtgaagtttccttgaggtatttgaagtggtggaagctcatcaatttcatccttagctatatttagcaaccaatcaacaaccttgctaggttggttta |
5012160 |
T |
 |
| Q |
115 |
gccctaacctgtcttgaagatcatagaggtgaattgctgtttggattgaaagccttacccttctatctcttagtcctttt |
194 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012159 |
gccctaacctatcttgaagatcatagaggtgaattgctgtttggattgaaagccttacccttctatctcttagtcctttt |
5012080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 44 - 184
Target Start/End: Complemental strand, 4516403 - 4516263
Alignment:
| Q |
44 |
tggtggaagctcatcaatttcatccttagctatatttagcaaccaatcaacaaccttgctaggttggtttagccctaacctgtcttgaagatcatagagg |
143 |
Q |
| |
|
||||||||| | |||||| || | |||||| ||| ||||||||||||||||| ||||||||||| || ||||||||||| |||||||||||||| || |
|
|
| T |
4516403 |
tggtggaagttgatcaatatcttgtttagctgcattgagcaaccaatcaacaactttgctaggttgattaagccctaacctatcttgaagatcataaagt |
4516304 |
T |
 |
| Q |
144 |
tgaattgctgtttggattgaaagccttacccttctatctct |
184 |
Q |
| |
|
||||| |||||| | | |||||||||||| ||||||||||| |
|
|
| T |
4516303 |
tgaatagctgttggtactgaaagccttactcttctatctct |
4516263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 126 - 186
Target Start/End: Complemental strand, 7969305 - 7969245
Alignment:
| Q |
126 |
tcttgaagatcatagaggtgaattgctgtttggattgaaagccttacccttctatctctta |
186 |
Q |
| |
|
|||||||||||||| | |||||||||||| | | ||||||||||| |||||||||||||| |
|
|
| T |
7969305 |
tcttgaagatcatataattgaattgctgttggaactgaaagccttatccttctatctctta |
7969245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University