View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9569_low_11 (Length: 240)
Name: NF9569_low_11
Description: NF9569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9569_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 51591111 - 51591342
Alignment:
| Q |
1 |
ttccgaattcccattccatcccttcgctcttctcccattactccttaattctgcttccgtttcccggacccgacccgattccgacagtttcgacccattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51591111 |
ttccgaattcccattccatcccttcgctcttctcccattactccttaattctgcttccgtttcccggacccgacccgattccgacagtttcgacccattc |
51591210 |
T |
|
| Q |
101 |
gctttccttcagaatcatctcaacggccttcacgccgacggtgcaaacattcaattcgagatcaataatccttctgaatccgaacctgggtttcgtgttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51591211 |
gctttccttcagaatcatctcaacggccttcacgccgacggtgcaaacattcaattcgagatcaataatccttctgaatccgaacctgggtttcgtgttc |
51591310 |
T |
|
| Q |
201 |
cctctaaccttggcgattacttcctctgtgct |
232 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
51591311 |
cctctaaccttggcgattacttcctcggtgct |
51591342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University