View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9570_high_8 (Length: 216)
Name: NF9570_high_8
Description: NF9570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9570_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 13 - 112
Target Start/End: Complemental strand, 32782740 - 32782641
Alignment:
| Q |
13 |
ttattcttatcaaatccaaataaaaattaatagtacaatatatgactaagacacgtaccataaatttaataatacagtccttgtttagttggccttattt |
112 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32782740 |
ttattcttatcaaatccaaatcaaaattaatagtacaatatatgactaagacacgtaccataaatttaataatacagtccttgtttagttggccttattt |
32782641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 107 - 197
Target Start/End: Complemental strand, 32782581 - 32782481
Alignment:
| Q |
107 |
ttatttaacctctcaaaacaagccttatctaatgtgggttaatctag----------ttgaaaatttattcatgaactttgatgatttagatttgatact |
196 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
32782581 |
ttatttaacctctcaaaacaagccttatttaatgtgggttagtctagaatcaattagttgaaaatttactcatgaattttgatgatttagatttgatact |
32782482 |
T |
 |
| Q |
197 |
c |
197 |
Q |
| |
|
| |
|
|
| T |
32782481 |
c |
32782481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University