View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9570_low_14 (Length: 250)
Name: NF9570_low_14
Description: NF9570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9570_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 47323763 - 47323524
Alignment:
| Q |
1 |
aaggattctaatgagtccaaacccacctggtgaagtgtgattcatcaatccaccccacatatcacacaaatcatttaagaactcttttttgcatatgaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47323763 |
aaggattctaatgagtccaaacccacctggtgaagtgttattcattaatccaccccacatatcacacaaatcatttaagaactcttttttgcatatgaga |
47323664 |
T |
 |
| Q |
101 |
ttcaaagacttattgtaatctttgcaagcaaaacaattcagaagataaatagaccaacattgaagttgactagcccattcctcggcttttcgattctcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47323663 |
ttcaaagacttattgtaatctttgcaagcaaaacaattcagaagataaatagaccaacattgaagttgactagcccattcctcggcttttcgattctcca |
47323564 |
T |
 |
| Q |
201 |
tttccaaatcacctaaacctcttgtaagcaagtttctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47323563 |
tttccaaatcacctaaacctcttgtaagcaagtttctgtg |
47323524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University