View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9570_low_2 (Length: 393)
Name: NF9570_low_2
Description: NF9570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9570_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 18 - 383
Target Start/End: Complemental strand, 47711080 - 47710715
Alignment:
| Q |
18 |
acttgggcagagagcatgcatatagatttatctgtattctgtactcacatgttctatatcattttgtggatttttgttagccctctggatgttaatgaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47711080 |
acttgggcagagagcatgcatatagatttatctgtattctgtactcacatgttctatatcattttgtggatttttgttagccctctggatgttaatgaca |
47710981 |
T |
|
| Q |
118 |
gtaagatactactttttggtgctaaattgcggttgtggttatgctgcaaaatttgatattgcagcaaaatacagcaaccgatacgggcacggttgcggtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47710980 |
gtaagatactactttttggtgctaaattgcggttgtggttatgctgcaaaatttgatattgcagcaaaatacagcaaccgatacggacacggttgcggtt |
47710881 |
T |
|
| Q |
218 |
acaatgctgctgtggaaacctctaaaaccttttatattatggctgcaatttcagtctcgaaccgcaatttagaaatattgtgtgacatatgcttgattgc |
317 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47710880 |
acaatgctgctgcggaaacctctaaaaccttttatattatggctgcagtttcagtctcgaaccgcaatttagaaatattgtgtgacatatgcttgattgc |
47710781 |
T |
|
| Q |
318 |
tttgtttgattatcaagcttatttacagttgaactcagcaaaatcgaatggaaattatatcaacac |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47710780 |
tttgtttgattatcaagcttatttacagttgaactcagcaaaatcgaatggaaattatatcaacac |
47710715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University