View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9571_low_12 (Length: 300)
Name: NF9571_low_12
Description: NF9571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9571_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 22 - 292
Target Start/End: Original strand, 38761932 - 38762204
Alignment:
| Q |
22 |
atatctcatcatatattagtaattgatttcaccactcaccagctaaagatcacacaccttttata--tataatttaggtgatctattgatcataaaagca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38761932 |
atatctcatcatatattagtaattgatttcaccactcaccagctaaagatcgcacaccttttatatatataatttaggtgatctattgatcataaaagca |
38762031 |
T |
|
| Q |
120 |
aatcagctagtaagatgaaaataaacaatccatatttggttgtggtaatcatacaagccatatatgctgctatgtttcttctgtcaaaagctgcattcga |
219 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38762032 |
aatcagctagtaagatgaaaagaaacaatccatatttggttgtggtaatcatacaagccatatatgctgctatgtttcttctgtcaaaagctgcattcga |
38762131 |
T |
|
| Q |
220 |
ccatggcatgaacaatttcgtctttgttttctacagacaatctgcagctactatttttctcacaccctttgct |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38762132 |
ccatggcatgaacaatttcgtctttgttttctacagacaatctgcagctactatttttctcacaccttttgct |
38762204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 190 - 259
Target Start/End: Original strand, 43620913 - 43620982
Alignment:
| Q |
190 |
tatgtttcttctgtcaaaagctgcattcgaccatggcatgaacaatttcgtctttgttttctacagacaa |
259 |
Q |
| |
|
||||||||| || |||||||||||||| || |||||||| ||||||||| ||||||| ||||| |||||| |
|
|
| T |
43620913 |
tatgtttctactctcaaaagctgcatttgatcatggcatcaacaatttcatctttgtgttctatagacaa |
43620982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University