View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9571_low_15 (Length: 254)
Name: NF9571_low_15
Description: NF9571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9571_low_15 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 102 - 254
Target Start/End: Complemental strand, 6940024 - 6939873
Alignment:
| Q |
102 |
ttactaaaattcttgtgttagggcaaactttgcctttggctcaatcaacacaacataattgtcgttactttaacataaaagtgccaattcgatattatat |
201 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6940024 |
ttactaaaaatcttgtgttagggcaaacattgcctttggctcaatcaacacaacataattgtcgttactttaacataaaagtgccaattcgatattatat |
6939925 |
T |
|
| Q |
202 |
aaaatacatgttccttcaaattggagcaaaaaattattggattatttgtgttt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6939924 |
aaaatacatgttccttcaaattggagca-aaaattattggattatttgtgttt |
6939873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University