View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9571_low_22 (Length: 238)
Name: NF9571_low_22
Description: NF9571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9571_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 25209006 - 25209219
Alignment:
| Q |
1 |
atccaatcttatttatatttatagccatatcgtttatataagtgaagggttttctcttttgatttgtccacccatgaaagtgcaaattagaaaaccaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
25209006 |
atccaatcttatttatatttatagccatatcgt----------gaagggttttctcttttgatttgtccacccatgaaagtgcaaattagaaaaccttgt |
25209095 |
T |
|
| Q |
101 |
aaattctttagatagtcaatgggcggcagaaataggaataagagaacaagtttctcttctcaaatgtgttctctttttacccattacatattcatcattt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25209096 |
aaattctttagatagtcaatgggtggcagaaataggaataagagaacaagtttctcttctcatatgtgttctctttttacccattacatattcatcattt |
25209195 |
T |
|
| Q |
201 |
ctcaccatccttaacccacttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
25209196 |
ctcaccatccttaacccacttttt |
25209219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 145 - 224
Target Start/End: Original strand, 25197438 - 25197517
Alignment:
| Q |
145 |
aacaagtttctcttctcaaatgtgttctctttttacccattacatattcatcatttctcaccatccttaacccacttttt |
224 |
Q |
| |
|
||||||||||| | |||| |||||| ||||| ||||||||||||||| | ||||||||||||||| ||||||||||| |
|
|
| T |
25197438 |
aacaagtttctttgctcatttgtgtttccttttcacccattacatattccacttttctcaccatcctttacccacttttt |
25197517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University