View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9572_high_6 (Length: 245)

Name: NF9572_high_6
Description: NF9572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9572_high_6
NF9572_high_6
[»] chr1 (1 HSPs)
chr1 (1-230)||(15359635-15359864)


Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 15359864 - 15359635
Alignment:
1 tttcttaaacactgaaatcaatggtaacaattcaatctatggacaatgtagatgaagaagcaattgagaaagaaagggaagattattcacaacatgcaga 100  Q
    ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||    
15359864 tttcttaaacactgaaatcaatgttaacaattaaatctatggacaatgtagatgaagaagaaattgagaaagaaagggaagattattcacaacattcaga 15359765  T
101 agcaacttcactgatagtggaagagctaacaacttccactgaattaagttcaaacaattctatacttgcaaatggtggttatgaaacaagggagagtgta 200  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||| ||||||||||||| ||||    
15359764 agcaacttcactgatagtggaaaagctaacaacttccactgaattaagctcaaacaattctacatttgcaaatggtggttacgaaacaagggagaatgta 15359665  T
201 acaaggctaagtactgaatcaaatcctgat 230  Q
    |||||||||||||||||||||||| |||||    
15359664 acaaggctaagtactgaatcaaattctgat 15359635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University