View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9572_low_18 (Length: 245)
Name: NF9572_low_18
Description: NF9572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9572_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 15359864 - 15359635
Alignment:
| Q |
1 |
tttcttaaacactgaaatcaatggtaacaattcaatctatggacaatgtagatgaagaagcaattgagaaagaaagggaagattattcacaacatgcaga |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15359864 |
tttcttaaacactgaaatcaatgttaacaattaaatctatggacaatgtagatgaagaagaaattgagaaagaaagggaagattattcacaacattcaga |
15359765 |
T |
|
| Q |
101 |
agcaacttcactgatagtggaagagctaacaacttccactgaattaagttcaaacaattctatacttgcaaatggtggttatgaaacaagggagagtgta |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||| ||||||||||||| |||| |
|
|
| T |
15359764 |
agcaacttcactgatagtggaaaagctaacaacttccactgaattaagctcaaacaattctacatttgcaaatggtggttacgaaacaagggagaatgta |
15359665 |
T |
|
| Q |
201 |
acaaggctaagtactgaatcaaatcctgat |
230 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
15359664 |
acaaggctaagtactgaatcaaattctgat |
15359635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University