View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9572_low_20 (Length: 241)
Name: NF9572_low_20
Description: NF9572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9572_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 7e-67; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 43227441 - 43227626
Alignment:
| Q |
1 |
atagtcacaacctgaaatcaaagaaagtagtaaaattatagcgaaatacatgaaccnnnnnnncacaaaatgcagatttaattcaagggagaaataaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43227441 |
atagtcacaacctgaaatcaaagaaagtagtaaaattatagcgaaatacatgaaccaaaaaaacacaaaatgcagatttaattcaagggagaaataaaca |
43227540 |
T |
 |
| Q |
101 |
tgtttataataagttgttaatgggatgttatacatgnnnnnnnntaagcttattagaagtttaattatactaaatgggctaccattt |
187 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43227541 |
tgtttctaatatgttgttaatgggatgttatacatg-aaaaaaataagcttattagaagtttaattatactaaatgggctaccattt |
43227626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 64 - 122
Target Start/End: Original strand, 43237024 - 43237082
Alignment:
| Q |
64 |
cacaaaatgcagatttaattcaagggagaaataaacatgtttataataagttgttaatg |
122 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||| | |||||||| |
|
|
| T |
43237024 |
cacaaaatgcagatttaattcaagggaaaattaaacatgtttataatatggtgttaatg |
43237082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 145 - 187
Target Start/End: Original strand, 43237098 - 43237140
Alignment:
| Q |
145 |
taagcttattagaagtttaattatactaaatgggctaccattt |
187 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
43237098 |
taagcttattagaagtttaattatattaaatgggctactattt |
43237140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University