View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9572_low_23 (Length: 216)
Name: NF9572_low_23
Description: NF9572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9572_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 198
Target Start/End: Original strand, 3125911 - 3126090
Alignment:
| Q |
19 |
aaggagaacaagagtggagacaacatatgaataggcaatgaagacatagtaactcaaccctttttgagtagctgctttgaatagaacactaacaccaacg |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3125911 |
aaggagaacaagagtggagacaacaaatgaataggcaatgaagacatagtaactcaaccctttttgagtagctgctttgaatagaacactgacaccaacg |
3126010 |
T |
|
| Q |
119 |
tttgtgcactctattgcaaccattgctgtgaatgggagcacatctttgtaacaatgcctccctgccatctctccctctct |
198 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
3126011 |
tttgtgcactctattgcaaccattgccgtgaatgggagcacatccttgtaacaatgcctccctgccatctctctctctct |
3126090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 3556122 - 3556027
Alignment:
| Q |
19 |
aaggagaacaagagtggagacaacatatgaataggcaatgaagacatagtaactcaaccctttttgagtagctgctttgaatagaacactaacacc |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3556122 |
aaggagaacaagagtggagacaacaaatgaataggcaatgaagacatagtaactcaactccttttgagtagctgctttgaatagaacactaacacc |
3556027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University