View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9573_high_14 (Length: 294)
Name: NF9573_high_14
Description: NF9573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9573_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 61 - 225
Target Start/End: Complemental strand, 8019513 - 8019349
Alignment:
| Q |
61 |
aggttttaactaattgcatatgattatgaaagttgttagtccttaacaattgtatgattttaggctgatatcactggtctggtatatgcacaaagtgttg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |||||| ||||||||||||||||| |
|
|
| T |
8019513 |
aggttttaactaattgcatatgattatgaaagttgttagtccttaacgattgtatgattttaggctaatatcactagtctggcatatgcacaaagtgttg |
8019414 |
T |
 |
| Q |
161 |
tcgaaacttgtagcaaccagattgaagttgattgtcgatcgttaaagggaggcaaatattggatg |
225 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8019413 |
tcgaaagttgtagcaaccagattgaagttgattgtcgatcgttaaagggaggcaaatattggatg |
8019349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 219 - 279
Target Start/End: Complemental strand, 8019325 - 8019265
Alignment:
| Q |
219 |
ttggatgtggtcatgtccaaaatgaatttcgtagtcttatggagaagatggactatgatgt |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8019325 |
ttggatgtggtcatgtccaaaatgaatttcgtagtcttatggagaagatggactatgatgt |
8019265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 13 - 68
Target Start/End: Original strand, 12217255 - 12217309
Alignment:
| Q |
13 |
aacttgttccacaaactatccaggtagttagttttaactaactgtaataggtttta |
68 |
Q |
| |
|
|||||||||||||| |||| || ||||||||| |||||||||||||||||||||| |
|
|
| T |
12217255 |
aacttgttccacaagttatctag-tagttagttgtaactaactgtaataggtttta |
12217309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University