View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9573_high_21 (Length: 238)
Name: NF9573_high_21
Description: NF9573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9573_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 8436861 - 8436953
Alignment:
| Q |
1 |
aagtggaattcaatggttatgcttgtgcagtaataaaaggtgagaatgggaatcattggtgcgtgcaattaataagcttgttctttacaagttt |
94 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8436861 |
aagttgaattcaatg-ttatgcttgtgcagtaataaaaggtgagaatgggaatcattggtgcgtgccattaataagcttgttctttacaagttt |
8436953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University