View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9573_high_22 (Length: 230)
Name: NF9573_high_22
Description: NF9573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9573_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 50762997 - 50762804
Alignment:
| Q |
18 |
agatgtgtacttttaaggttgaggagtgtagt---ctcttgttgtttaacnnnnnnnatatattggtgtgcatgacaaatggaaatggaagttatattcg |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||||| | |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
50762997 |
agatgtgtacttt-aaggttgaggagtgtagtagtctcttgttgtttaactttttttacatattggtgtgcat-acaaatggaaatggaagttatattcg |
50762900 |
T |
 |
| Q |
115 |
gacaaaggatactcaattagtggtgtttatcatttgttggtcatggaaatgtcaaaggatagctcaatcctctatgatattgtttggataaaagtg |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50762899 |
gacaaaggatactcaatcagtggtgtttatcatttgttggtcatggaaatgtcaaaggatagatcaatcctctatgatattgtttggataaaagtg |
50762804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 39280512 - 39280464
Alignment:
| Q |
161 |
aaatgtcaaaggatagctcaatcctctatgatattgtttggataaaagt |
209 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
39280512 |
aaatgtcaagagatatatcactcctctatgatattgtttggataaaagt |
39280464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University