View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9573_low_22 (Length: 336)
Name: NF9573_low_22
Description: NF9573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9573_low_22 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 153 - 336
Target Start/End: Complemental strand, 30775801 - 30775618
Alignment:
| Q |
153 |
cttatgaaataagtcgattaaaatttatgcttcgattcaaacaacgtccattgggttgtaacttccgataagttttgtgtgattctcaattacaattgat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30775801 |
cttatgaaataagtcgattaaaatttatgcttcgattcaaacaacgtccattgggtcgtaacttccgataagttttgtgtgattctcaattacaattgat |
30775702 |
T |
|
| Q |
253 |
aaattttagagatttttaagcaaacttagtagtccgtagagcaatcaccatgttttttctacttggaagtattatctacccacc |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| || ||||| |
|
|
| T |
30775701 |
aaattttagagatttttaagcaaacttagtggtccgtagagcaatcaccatgttttttctacttggaagtactatgtaaccacc |
30775618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 30775842 - 30775793
Alignment:
| Q |
18 |
atgtcattccatttttatcataaactgatgcatgtcccttcccttatgaaa |
68 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30775842 |
atgtcattccatttt-atcataaactgatgcatgtcccttcccttatgaaa |
30775793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University