View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9573_low_46 (Length: 252)
Name: NF9573_low_46
Description: NF9573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9573_low_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 13 - 211
Target Start/End: Original strand, 10495122 - 10495320
Alignment:
| Q |
13 |
gttcaatgaggtccatgtaagtagaaaaaacctgatagcaatccaaaatatggttatactttaaggcggtggagtgcgtcaaacgctctatttacttatg |
112 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10495122 |
gttcaatgaggtccatgtaagtaggaaaaacttgataacaatccaaaatatggttatactttaaggcggtggagcgcgtcaaacgctctatttacttatg |
10495221 |
T |
|
| Q |
113 |
aggtaggagtgaggtagtttatgaaatgtagtaaaaggtagttactcttagttgcacgttgttatggaatgctatttctcttgaggtgatgcaagaggt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| || |||||||| ||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
10495222 |
aggtaggagtgaggtagtttatgaaatgtagtaaaaggttgttaccctgagttgcacattgttctggaatgctatttctcttgaggtggtgcaagaggt |
10495320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University