View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9573_low_48 (Length: 251)
Name: NF9573_low_48
Description: NF9573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9573_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 36167866 - 36168109
Alignment:
| Q |
1 |
tcttaagtttggttagatatccgactctcgtaaactctcactaacttgaacgttgaagttcttacatgtaaattctttggagaataacgatgtccacatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
36167866 |
tcttaagtttggttagatatccgactctcgtaaactctcactaatttgaacgttgaagttcttacatgtaaattctctggagaataacgatgtccgcatt |
36167965 |
T |
 |
| Q |
101 |
caaccaaccttcttctatcgtcgtattcaggttaactcttgatcacttggaatactcaaattatacactattcttttagatttgaaccatagattttttc |
200 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
36167966 |
caaccaaccttcttcgatcgtcatattcaggttaaatcttgatcatttggaatactcaaattatatactattcttttagatttgaaccatggattttttc |
36168065 |
T |
 |
| Q |
201 |
ttcgatatataaatgcaagatacacactttcttgagaattatct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36168066 |
ttcgatatataaatgcaagatacacactttcttaagaattatct |
36168109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University