View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9575_low_10 (Length: 202)
Name: NF9575_low_10
Description: NF9575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9575_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 190
Target Start/End: Complemental strand, 37056195 - 37056016
Alignment:
| Q |
15 |
tggtgttaggcaagtccaacaaaacatgaccccacagcagtccacatttacaattttttgattaaataacttttaactactaaaaagttttatga----t |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37056195 |
tggtgttaggcaagtccaacaaaacatgaccccacagcagtccacatttacaattttttgattaaataacttttaactactaaaaagttttatgatccat |
37056096 |
T |
|
| Q |
111 |
ccaacatcaaagatcatgtctcaattcccagatactaaaccttttgaatcatcatcaatcaaattataatgctaaaaagc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37056095 |
ccaacatcaaagatcatgtctcaattcccagatactaaaccttttgaatcatcatcaatcaaattataatgctaaaaagc |
37056016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University