View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9575_low_4 (Length: 241)
Name: NF9575_low_4
Description: NF9575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9575_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 227
Target Start/End: Original strand, 3986372 - 3986580
Alignment:
| Q |
19 |
gtttatatattttgatatgttctttaatatttcattgtaggatgaactgatgaacaatgaacaactgttttttgccctctgtcagtttttgcgtaaattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3986372 |
gtttatatattttgatatgttctttaatatttcattgtaggatgaactgatgaacaatgaacaactgttttttgccctctgtcagtttttgcgtaaattt |
3986471 |
T |
 |
| Q |
119 |
ccaaaagagactggtaactaagatcataattgaactgaaattagcctttaagtttatacatcttcggtagtaacacttacatactgtatggtttcagata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3986472 |
ccaaaagagactggtaactaagatcataattgaactgaaattagcctttaagtttatacatcttcggtagtaacacatacatactgtatggtttcagata |
3986571 |
T |
 |
| Q |
219 |
gagtattat |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
3986572 |
gagtattat |
3986580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University