View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9576_high_5 (Length: 243)

Name: NF9576_high_5
Description: NF9576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9576_high_5
NF9576_high_5
[»] chr5 (2 HSPs)
chr5 (16-224)||(31868799-31869007)
chr5 (165-224)||(36231903-36231962)
[»] chr3 (1 HSPs)
chr3 (153-224)||(43200634-43200705)


Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 224
Target Start/End: Original strand, 31868799 - 31869007
Alignment:
16 gagacggaggagctaaagtagtaggaagaggaagaggttgagagtttgcacttgtaggcattgatacttgagaagaaatgaaactagctgcttctctata 115  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31868799 gagacggaggagctaaagtcgtaggaagaggaagaggttgagagtttgcacttgtaggcattgatacttgagaagaaatgaaactagctgcttctctata 31868898  T
116 tttgtattttagtagctcagttcttactgcatgtaactctgcttgtaaagattggacttgttgttgtaatgatgatattgcacccatgcatccataaaca 215  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31868899 tttgtattttagtagctcagttcttactgcatgcaactctgcttgtaaagattggacttgttgttgtaatgatgatattgcacccatgcatccataaaca 31868998  T
216 ggatctctt 224  Q
    |||||||||    
31868999 ggatctctt 31869007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 165 - 224
Target Start/End: Original strand, 36231903 - 36231962
Alignment:
165 gattggacttgttgttgtaatgatgatattgcacccatgcatccataaacaggatctctt 224  Q
    ||||| ||||||||||| || ||||| ||||||||||||||||||||||| |||||||||    
36231903 gattgaacttgttgttgcaaagatgaaattgcacccatgcatccataaactggatctctt 36231962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 153 - 224
Target Start/End: Original strand, 43200634 - 43200705
Alignment:
153 tctgcttgtaaagattggacttgttgttgtaatgatgatattgcacccatgcatccataaacaggatctctt 224  Q
    ||||||||||||||||| || |||||||| ||||  || ||||||||||||||||||||||| |||||||||    
43200634 tctgcttgtaaagattgaacctgttgttgcaatgcagaaattgcacccatgcatccataaactggatctctt 43200705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University