View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9576_low_12 (Length: 243)
Name: NF9576_low_12
Description: NF9576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9576_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 224
Target Start/End: Original strand, 31868799 - 31869007
Alignment:
| Q |
16 |
gagacggaggagctaaagtagtaggaagaggaagaggttgagagtttgcacttgtaggcattgatacttgagaagaaatgaaactagctgcttctctata |
115 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31868799 |
gagacggaggagctaaagtcgtaggaagaggaagaggttgagagtttgcacttgtaggcattgatacttgagaagaaatgaaactagctgcttctctata |
31868898 |
T |
 |
| Q |
116 |
tttgtattttagtagctcagttcttactgcatgtaactctgcttgtaaagattggacttgttgttgtaatgatgatattgcacccatgcatccataaaca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31868899 |
tttgtattttagtagctcagttcttactgcatgcaactctgcttgtaaagattggacttgttgttgtaatgatgatattgcacccatgcatccataaaca |
31868998 |
T |
 |
| Q |
216 |
ggatctctt |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
31868999 |
ggatctctt |
31869007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 165 - 224
Target Start/End: Original strand, 36231903 - 36231962
Alignment:
| Q |
165 |
gattggacttgttgttgtaatgatgatattgcacccatgcatccataaacaggatctctt |
224 |
Q |
| |
|
||||| ||||||||||| || ||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
36231903 |
gattgaacttgttgttgcaaagatgaaattgcacccatgcatccataaactggatctctt |
36231962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 153 - 224
Target Start/End: Original strand, 43200634 - 43200705
Alignment:
| Q |
153 |
tctgcttgtaaagattggacttgttgttgtaatgatgatattgcacccatgcatccataaacaggatctctt |
224 |
Q |
| |
|
||||||||||||||||| || |||||||| |||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
43200634 |
tctgcttgtaaagattgaacctgttgttgcaatgcagaaattgcacccatgcatccataaactggatctctt |
43200705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University