View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9577_low_10 (Length: 257)
Name: NF9577_low_10
Description: NF9577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9577_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 23072397 - 23072157
Alignment:
| Q |
11 |
cagagacgatgaccttgtgtcgacaaggttgagaagtaatgttgatagtaataagatcgaaatgccaaaattttgcattcctattttaaggaaggaaaag |
110 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23072397 |
cagagacgatgaccttgtgtcgtcaaggttgagaagcattgttgatagtaataagatcgaaaggccaaaattttgcattcctatttcaaggaaggaaaag |
23072298 |
T |
|
| Q |
111 |
gaggaagatttcatgacgtttttgggtcgtgcaccgcggcagaggcccattaagaggcctaaaaaggttcagaagcagataaacgtatgttgcatannnn |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23072297 |
gaggaagatttcttgacgtttttgggtcgtgcaccgcggcagaggcccattaagaggcctaaaaaggttcagaagcagataaacgtatgtcgcatatttt |
23072198 |
T |
|
| Q |
211 |
nnnnnnnnnattattccctaatccttgatttgattttgttt |
251 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |
|
|
| T |
23072197 |
tcctttttaattattccctaatccttgatatgattttgttt |
23072157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University