View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9577_low_13 (Length: 210)
Name: NF9577_low_13
Description: NF9577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9577_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 4680078 - 4679899
Alignment:
| Q |
17 |
aataacaattaacaactaatcaaagcacaagttcaatgaatagacaattataaagagttcaaaagatagaaaaaa-tgcaccaaaagaattaaacaggat |
115 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4680078 |
aataacaattaacaactaatcacatcacaagttcaatgaatagacaattataaagagttcaaaagatagaaaaaaatgcaccaaaagaattaaacaggat |
4679979 |
T |
 |
| Q |
116 |
acagtggaactgtccatatatacccattcttgcaccttcaaatgctatgtaagttatctaatgaaggtaatttctcacag |
195 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4679978 |
acagtggaactgtccatgtatacccattcatgcaccttcaaatgctatgtaagttatctaatgagggtaatttctcacag |
4679899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University