View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9578_high_20 (Length: 213)
Name: NF9578_high_20
Description: NF9578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9578_high_20 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 3 - 213
Target Start/End: Complemental strand, 23072023 - 23071814
Alignment:
| Q |
3 |
gcttttgatgatggaaactatatatcttcagtgatatatagtttttacttctgaatctttgagatggtgctattattagggnnnnnnnn-atagatatta |
101 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23072023 |
gcttttgatgatggaaactatat--cttcagtgatatatagtttttacttctgaacctttgagatggtgctattattagggtttttttttatagatatta |
23071926 |
T |
 |
| Q |
102 |
tatggttagttcattctttttgtttgctctactagaaaatttggtgatatatgagaccgtggttaagttttatggtgtgagattatattcaatgatgcaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23071925 |
tatggttagttcattctttttgtttgctctactggaaaatttggtgatatatgagaccgtggttaagttttatggtgtgagattatattcaatgatgcaa |
23071826 |
T |
 |
| Q |
202 |
ctcaaatgtgtc |
213 |
Q |
| |
|
|||||||||||| |
|
|
| T |
23071825 |
ctcaaatgtgtc |
23071814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 61 - 126
Target Start/End: Complemental strand, 23096130 - 23096065
Alignment:
| Q |
61 |
ttgagatggtgctattattagggnnnnnnnnatagatattatatggttagttcattctttttgttt |
126 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
23096130 |
ttgagatggtgctaatattagggttttttttatagatataatatggttagttcattctttttgttt |
23096065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University