View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9578_high_22 (Length: 201)
Name: NF9578_high_22
Description: NF9578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9578_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 15 - 186
Target Start/End: Original strand, 8821440 - 8821611
Alignment:
| Q |
15 |
cagagagatcattaagctgcatctgagttagagccattagagactttaacacatctgaatagtttgcaaatgtataattgtttccacatattgcttgaac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8821440 |
cagagagatcattaagctgcatctgagttagagccattagagactttaacacatctgaatagtttgcaaatgtataattgtttccacatattgcttgaac |
8821539 |
T |
 |
| Q |
115 |
ccatatggctgtcacaaatcctagccatttttcagctgcaaaattattattagagaataacaacatagtgat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8821540 |
ccatatggctgtcacaaatcctagccatttttcagctgcaaaattattattagagaataacaacatagtgat |
8821611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University