View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9578_low_21 (Length: 344)
Name: NF9578_low_21
Description: NF9578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9578_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 19 - 336
Target Start/End: Original strand, 12147357 - 12147674
Alignment:
| Q |
19 |
actattgggcggcctaagttaatgatttgatttttgagtaaacttctctctaatgggaaaaataatttgaggaatccaactgatttgtatatattgactt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12147357 |
actattgggcggcctaagttaatgatttgatttttgagtaaacttctctctaatgggaaaaataatttgaggaatccaactgatttgtatatattgactt |
12147456 |
T |
 |
| Q |
119 |
tgttgatttttctgatcaaggaaatgtacatgtattgctattgctattcatattatgctcaattagctatgcatttttagctatgtatttttataactct |
218 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12147457 |
tgttgatttttttgatcaaggaaatgtacatgtattgctattgctattcatattatgctcaattagctatgtttttttagctatgtatttttataactct |
12147556 |
T |
 |
| Q |
219 |
gcaatctagttaatatggttaagccatgctaaagctttgtttggtcttcactcaataggggacagtgattaaaaaagtatgaacatcaacataggaatag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12147557 |
gcaatctagttaatatggttaagccatgctaaagctttgtttggtcttcactcaataggggacagtgattaaaaaagtatgaacatcaacataggaatag |
12147656 |
T |
 |
| Q |
319 |
ctgtcaaccagtattatc |
336 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
12147657 |
ctgtcaaccagtgttatc |
12147674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University