View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9578_low_26 (Length: 335)
Name: NF9578_low_26
Description: NF9578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9578_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 495177 - 495035
Alignment:
| Q |
1 |
aatcaatctctttaatctaggccttttgacaggcagactacaccgaaaacacaatattttctctgttcaagggggaaattatatttttaaagcattgata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
495177 |
aatcaatctctttaatctaggccttttgacaggcagactacactgattacacattattttctctgttctagggggaaattatatttttaaagcattgata |
495078 |
T |
 |
| Q |
101 |
taatagt-aattactaataactaatatatcatagtgcatcaaa |
142 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
495077 |
caatagtaaattactaataactaatttatcatagtgcatcaaa |
495035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 167 - 273
Target Start/End: Complemental strand, 10979640 - 10979533
Alignment:
| Q |
167 |
tagtttggtttctt-aggaatttattgtccacttcctgataagattcatcggctatctttgcttgaagttttggatttgagctcaaatttcttatttgat |
265 |
Q |
| |
|
|||||||||||||| |||||| | |||||||| ||||||| |||||| ||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
10979640 |
tagtttggtttctttaggaatatggggtccactttctgataaaattcataggctatctttgcttgaagttttggatttgagttcaaatttcttatttggt |
10979541 |
T |
 |
| Q |
266 |
tctattcc |
273 |
Q |
| |
|
|||||||| |
|
|
| T |
10979540 |
tctattcc |
10979533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University