View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9578_low_36 (Length: 248)
Name: NF9578_low_36
Description: NF9578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9578_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 101 - 243
Target Start/End: Complemental strand, 43507897 - 43507761
Alignment:
| Q |
101 |
atttacaagagatgtgacattttcttttaattttctacgactctgtttgttcaattcactgccattttgtggtataactataaggcaataaaaatgcagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43507897 |
atttacaagagatgtgacattttcttttaattttctacgactctgtttgttcaattcactgccattttgtggt------ataaggcaataaaaatgcagt |
43507804 |
T |
 |
| Q |
201 |
tttattgactaataaactgtctttaacttatctaccaccaaac |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43507803 |
tttattgactaataaactgtctttaacttatctacccccaaac |
43507761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 85
Target Start/End: Complemental strand, 43507949 - 43507915
Alignment:
| Q |
51 |
ggttttcaatgtgctagcttctccaattcgattgc |
85 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43507949 |
ggttttcaatgtgttagcttctccaattcgattgc |
43507915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University