View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9578_low_37 (Length: 248)

Name: NF9578_low_37
Description: NF9578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9578_low_37
NF9578_low_37
[»] chr7 (2 HSPs)
chr7 (101-243)||(43507761-43507897)
chr7 (51-85)||(43507915-43507949)


Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 101 - 243
Target Start/End: Complemental strand, 43507897 - 43507761
Alignment:
101 atttacaagagatgtgacattttcttttaattttctacgactctgtttgttcaattcactgccattttgtggtataactataaggcaataaaaatgcagt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||||    
43507897 atttacaagagatgtgacattttcttttaattttctacgactctgtttgttcaattcactgccattttgtggt------ataaggcaataaaaatgcagt 43507804  T
201 tttattgactaataaactgtctttaacttatctaccaccaaac 243  Q
    |||||||||||||||||||||||||||||||||||| ||||||    
43507803 tttattgactaataaactgtctttaacttatctacccccaaac 43507761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 85
Target Start/End: Complemental strand, 43507949 - 43507915
Alignment:
51 ggttttcaatgtgctagcttctccaattcgattgc 85  Q
    ||||||||||||| |||||||||||||||||||||    
43507949 ggttttcaatgtgttagcttctccaattcgattgc 43507915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University