View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9578_low_39 (Length: 246)
Name: NF9578_low_39
Description: NF9578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9578_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 40 - 235
Target Start/End: Complemental strand, 45229932 - 45229737
Alignment:
| Q |
40 |
acttctagcttgtaaattacttggttgttgtccatgctgaatttttagtacttgcttcaggagtggttctgctttcaatagaaattaaatagtattatgc |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45229932 |
acttctagcttgtaaattacttggttgttgtccatgctgaatttttagtacttgcttcaggagtggttctgctttcaatagaaattaaatagtattatgc |
45229833 |
T |
 |
| Q |
140 |
ttgggaaggaagacaatgatcacatttaacattggaacaactaaattaatcaaaagtcaaagtggtaatcatgtttgcatcttcttatacagtata |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45229832 |
ttgggaaggaagacaatgatcacatttaacattggaacaactaaattaatcaaaagtcaaagtggtaatcatgtttgcatcttcttatacagtata |
45229737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University