View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9578_low_50 (Length: 222)
Name: NF9578_low_50
Description: NF9578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9578_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 11 - 166
Target Start/End: Complemental strand, 49170072 - 49169916
Alignment:
| Q |
11 |
agtttggtgttcgtcaactctgccctcactcattatgttgggtggaaagattattatcatatatagtttt-caaatgagacgagctaagatcattaaaag |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
49170072 |
agtttggtattcgtcaactctgccctcactcattatgttgggtggaaagattattatcatatatagtttttcaaatgagacgagctaagatcgttaaaag |
49169973 |
T |
|
| Q |
110 |
cggaaaatgaatttcttcagttctgcgccctcaaagtcaaatgtgagcttgatatct |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49169972 |
cggaaaatgaatttcttcagttctgcgccctcaaagtcaaatgtgagcttgatatct |
49169916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 80
Target Start/End: Original strand, 49180088 - 49180143
Alignment:
| Q |
25 |
caactctgccctcactcattatgttgggtggaaagattattatcatatatagtttt |
80 |
Q |
| |
|
||||||||||||||||| ||||| | | | ||||||||||||||| |||||||||| |
|
|
| T |
49180088 |
caactctgccctcactcgttatgcttgctagaaagattattatcacatatagtttt |
49180143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University