View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9578_low_55 (Length: 213)
Name: NF9578_low_55
Description: NF9578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9578_low_55 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 19 - 202
Target Start/End: Complemental strand, 48030933 - 48030750
Alignment:
| Q |
19 |
caactgtagtctgattttgttgtatctgactgattttgtatatgtgatatgatgtgctttatgaattatgatcaattttgctcaaatgatgtttaaatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48030933 |
caactgtagtctgattttgttgtatctgactgattttgtatatgtgatatgatgtgctttatgaattatgatcaattttgctcaaatgatgtttaaatga |
48030834 |
T |
|
| Q |
119 |
tggtaaaggtaagatgttagtgaaattgttgttttcaacggattttgcaactgttaactgtaaattgttagtgaagtatctgtg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48030833 |
cggtaaaggtaagatgttagtgaaattgttgttttcaacggattttgcaactgttaactgtaaattgttagtgaagtatctgtg |
48030750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 24 - 198
Target Start/End: Complemental strand, 48040023 - 48039857
Alignment:
| Q |
24 |
gtagtctgattttgttgtatctgactgattttgtatatgtgatatgatgtgctttatgaattatgatcaattttgctcaaatgatgtttaaatgatggta |
123 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||| |||| |
|
|
| T |
48040023 |
gtagcctgattttgttgtatccaactgattttgtatatgtgatatgatgtgctttatga-------tcaattttgctcaactgatgtttcaattc-ggta |
48039932 |
T |
|
| Q |
124 |
aaggtaagatgttagtgaaattgttgttttcaacggattttgcaactgttaactgtaaattgttagtgaagtatc |
198 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48039931 |
aaggtaaactgttagtgaaattgttgttttcaacagattttgcaactgttaactgtaatctgttagtgaagtatc |
48039857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University