View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9579_high_7 (Length: 228)
Name: NF9579_high_7
Description: NF9579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9579_high_7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 25 - 228
Target Start/End: Original strand, 48303396 - 48303597
Alignment:
| Q |
25 |
tggtcttacacacaagaaaagaagaccaaggttgaggatgaacttttggtactttatttagtcttacaagaatccattccagttagggtttggtctcatt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48303396 |
tggtcttacacacaagaaaagaagaccaaggttgaggatgagcttttggtactttatttagtcttacaagaatccattccagttagggtttggtctcatt |
48303495 |
T |
 |
| Q |
125 |
tcagacacacactgcaccaaaatagcaattcggacattccaacagcttcaacttcatacttcaattcttcatcgctggtgacccattttggtatgaatct |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48303496 |
tcagacacacactgcaccaaaatagca--tcggacattccaacagcttcaacttcatacttcaattcttcatcgctggtgacccattttggtacgaatct |
48303593 |
T |
 |
| Q |
225 |
tctt |
228 |
Q |
| |
|
|||| |
|
|
| T |
48303594 |
tctt |
48303597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University