View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9579_low_15 (Length: 332)
Name: NF9579_low_15
Description: NF9579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9579_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 89 - 315
Target Start/End: Complemental strand, 33492247 - 33492022
Alignment:
| Q |
89 |
tttattgtaccatatgcaattgctcgagctagagttccggcttcggttgacagtaattctccgttattaaaggtttgagagagccttgatgaaacccaac |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33492247 |
tttattgtaccatatgcaattgctcgagctaaagttccggcttcagttgacagtaattctccattattaaaggtttgagagagccttgatgaaacccaac |
33492148 |
T |
|
| Q |
189 |
tgacataccaaaatgacatcatacgacaaaatgaatacatggtatcttgctgacataccagtttctgattcatgtcatactagtttctaatttttaacct |
288 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33492147 |
tgacataccaaaatgacatcata-gacaaaatgaatacatggtatcttgctaacataccagtttctgattcatgtcatactagtttctaatttttaacct |
33492049 |
T |
|
| Q |
289 |
atctcagtttttgcttcatgtcaaaat |
315 |
Q |
| |
|
|||||||||| |||||||||||||||| |
|
|
| T |
33492048 |
atctcagtttctgcttcatgtcaaaat |
33492022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 80 - 155
Target Start/End: Original strand, 28809438 - 28809513
Alignment:
| Q |
80 |
cctgaaatttttattgtaccatatgcaattgctcgagctagagttccggcttcggttgacagtaattctccgttat |
155 |
Q |
| |
|
||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28809438 |
cctgaaattgttattgtaccatctgcaattactcgagctagagttccggcttcggttgacagtaatcctccgttat |
28809513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 214 - 261
Target Start/End: Original strand, 28811302 - 28811349
Alignment:
| Q |
214 |
acaaaatgaatacatggtatcttgctgacataccagtttctgattcat |
261 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
28811302 |
acaaaatgaatacatggaaccttgctgacataccagtttctgcttcat |
28811349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University