View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9579_low_24 (Length: 248)
Name: NF9579_low_24
Description: NF9579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9579_low_24 |
 | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 20050758 - 20050549
Alignment:
| Q |
1 |
tcgtttaccatatatttgcctttgagacacaacaacacagtaccgaaacaaagaaaacaagatttgatgtgtgctaaagtaggatactaggattatttgt |
100 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20050758 |
tcgtataccatatatttgcctttcagacacaacaacacagtaccgaaacaaagaaaacaagatttgatgtgtgctaaagtaggatactaggattaattgt |
20050659 |
T |
|
| Q |
101 |
gttattggttggatactaggattatttgtgttaatttgttaaaggaaaaaagagtgaagctttttattta--taatatataataaaaaggggagtttgag |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
20050658 |
gttattggttggatactaggattatttgtgttaatttattaaaggaaaaaagagtgaagctttttatttatttataatataataaaaaggggagtttgag |
20050559 |
T |
|
| Q |
199 |
tgataaaaaa |
208 |
Q |
| |
|
| |||||||| |
|
|
| T |
20050558 |
ttataaaaaa |
20050549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 203 - 238
Target Start/End: Complemental strand, 3118989 - 3118954
Alignment:
| Q |
203 |
aaaaaataggctaaactgcacttttcaccccctatg |
238 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3118989 |
aaaaaataggctaaactgcacttttcgccccctatg |
3118954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 238
Target Start/End: Original strand, 5645 - 5677
Alignment:
| Q |
206 |
aaataggctaaactgcacttttcaccccctatg |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
5645 |
aaataggctaaactgcacttttcgccccctatg |
5677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 202 - 238
Target Start/End: Original strand, 23765411 - 23765447
Alignment:
| Q |
202 |
taaaaaataggctaaactgcacttttcaccccctatg |
238 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
23765411 |
taaaaagtaggctaaactgcacttttcgccccctatg |
23765447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 202 - 238
Target Start/End: Original strand, 23815259 - 23815295
Alignment:
| Q |
202 |
taaaaaataggctaaactgcacttttcaccccctatg |
238 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
23815259 |
taaaaagtaggctaaactgcacttttcgccccctatg |
23815295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University