View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9579_low_25 (Length: 240)
Name: NF9579_low_25
Description: NF9579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9579_low_25 |
 | |
|
| [»] scaffold0459 (1 HSPs) |
| | |
|
| [»] scaffold0366 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0459 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 5745 - 5521
Alignment:
| Q |
1 |
acaaaatagacatgaagcattgaaatagacacaaacaccgaacacgacattcacacatcggataccggacacatctttattctgaagtgtcggttgtcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5745 |
acaaaatagacatgaagcattgaaatagacacaaacaccgaacacgacattcacacatcggataccggacacatctttattctgaagtgtcggttgtcat |
5646 |
T |
|
| Q |
101 |
tgatttctggttctaaagccaaacctatccttgcaggttgttggaaggtgatcatgcttcctttgttgagtcagtaccattcaaacatatagtattgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5645 |
tgatttctggttctaaagccaaacctatccttgcaggttgttggaaggtgatcatgcttcctttgttgagtcagtaccattcaaacatatagtattgttt |
5546 |
T |
|
| Q |
201 |
acactcttccaatgtgtgtatttct |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5545 |
acactcttccaatgtgtgtatttct |
5521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 5745 - 5521
Alignment:
| Q |
1 |
acaaaatagacatgaagcattgaaatagacacaaacaccgaacacgacattcacacatcggataccggacacatctttattctgaagtgtcggttgtcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5745 |
acaaaatagacatgaagcattgaaatagacacaaacaccgaacacgacattcacacatcggataccggacacatctttattctgaagtgtcggttgtcat |
5646 |
T |
|
| Q |
101 |
tgatttctggttctaaagccaaacctatccttgcaggttgttggaaggtgatcatgcttcctttgttgagtcagtaccattcaaacatatagtattgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5645 |
tgatttctggttctaaagccaaacctatccttgcaggttgttggaaggtgatcatgcttcctttgttgagtcagtaccattcaaacatatagtattgttt |
5546 |
T |
|
| Q |
201 |
acactcttccaatgtgtgtatttct |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5545 |
acactcttccaatgtgtgtatttct |
5521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University